As was foretold, we've added advertisements to the forums! If you have questions, or if you encounter any bugs, please visit this thread: https://forums.penny-arcade.com/discussion/240191/forum-advertisement-faq-and-reports-thread/
We're funding a new Acquisitions Incorporated series on Kickstarter right now! Check it out at https://www.kickstarter.com/projects/pennyarcade/acquisitions-incorporated-the-series-2

[Game On!] Left 4 Dead 1/2 - We still play this. Really!

1131416181949

Posts

  • subediisubedii Registered User regular
    edited September 2010
    So that's how Zoey got her skillz with a rifle.

    I was thinking watching horror movies at college wouldn't do much for your actual survival odds. :lol:

    subedii on
  • mogdemonmogdemon Kansas, USRegistered User regular
    edited September 2010
    Oh man, Zoey's backstory.
    :(

    mogdemon on
    apotheos wrote:
    You ever wonder exactly how many magic mushrooms the average japanese game studio design team consumes in a year?
    just got a 3ds! 3454-0598-2000
  • DeMoNDeMoN twitch.tv/toxic_cizzle Registered User regular
    edited September 2010
    Clearly this will end with them all being saved by the Midnight Riders.

    DeMoN on
    Steam id : Toxic Cizzle
    *TyCart*_banner.jpg
  • PopesnaxPopesnax Registered User regular
    edited September 2010
    God I love Valve so much for not just playing the "Evil Army" trope completely straight like in so many other zombie narratives

    Popesnax on
  • BethrynBethryn Unhappiness is Mandatory Registered User regular
    edited September 2010
    Two great things about the comic.
    Zoey killing her dad because of horror movies, unnecessarily.

    And the army guys listening to Francis and Louis. Sure, I don't think their survival odds are that great for mooks, but it's nice to see people being sensible for once.

    Bethryn on
    ...and of course, as always, Kill Hitler.
  • subediisubedii Registered User regular
    edited September 2010
    Popesnax wrote: »
    not just playing the "Evil Army" trope completely straight like in so many other zombie narratives

    I was honestly expecting it to go that way.

    subedii on
  • PopesnaxPopesnax Registered User regular
    edited September 2010
    subedii wrote: »
    Popesnax wrote: »
    not just playing the "Evil Army" trope completely straight like in so many other zombie narratives

    I was honestly expecting it to go that way.

    I hope those two soldiers survive and get cameos in the DLC or something

    also, time to start shipping shortsoldierxLouis. There's chemistry there.

    Popesnax on
  • Undead ScottsmanUndead Scottsman Registered User regular
    edited September 2010
    Short soldier x Francis more like it. Angry sex is the best sex.

    Undead Scottsman on
  • AegeriAegeri Tiny wee bacteriums Plateau of LengRegistered User regular
    edited September 2010
    Yeah, I was amazed at the concept they wouldn't portray the army as being reprehensibly evil. I wonder if we will get an answer about carriers spreading the disease from this.

    Aegeri on
    The Roleplayer's Guild: My blog for roleplaying games, advice and adventuring.
  • Undead ScottsmanUndead Scottsman Registered User regular
    edited September 2010
    Aegeri wrote: »
    Yeah, I was amazed at the concept they wouldn't portray the army as being reprehensibly evil. I wonder if we will get an answer about carriers spreading the disease from this.

    ...did you read chapter 2?

    Undead Scottsman on
  • PopesnaxPopesnax Registered User regular
    edited September 2010
    Short soldier x Francis more like it. Angry sex is the best sex.

    Of course, they can't consummate their relationship because she'll turn into a zombie

    oh god, Francis is Edward Cullen

    Popesnax on
  • DeMoNDeMoN twitch.tv/toxic_cizzle Registered User regular
    edited September 2010
    Popesnax wrote: »
    Short soldier x Francis more like it. Angry sex is the best sex.

    Of course, they can't consummate their relationship because she'll turn into a zombie

    oh god, Francis is Edward Cullen

    Francis and Rochelle will be reunited again someday.

    At their wedding, instead of vows, they will list the things they hate about each other.

    DeMoN on
    Steam id : Toxic Cizzle
    *TyCart*_banner.jpg
  • JobastionJobastion Registered User regular
    edited September 2010
    Guesing, page 50, center top panel.
    I'm guessing the editor forgot to run spell checker.
    I'm guessing I'm being a goddamn grammar nazi and should shut the hell up Francis.
    I likes it!

    Jobastion on
    Recommended reading - Worm (Superhero Genre) & Pact (Modern Fantasy Thriller) |
    Backlog Wars - Sonic Generations | Steam!
    Viewing the forums through rose colored glasses... or Suriko's Ye Old Style and The PostCount/TimeStamp Restoral Device
  • AegeriAegeri Tiny wee bacteriums Plateau of LengRegistered User regular
    edited September 2010
    Aegeri wrote: »
    Yeah, I was amazed at the concept they wouldn't portray the army as being reprehensibly evil. I wonder if we will get an answer about carriers spreading the disease from this.

    ...did you read chapter 2?

    Yes, but I've not actually seen that confirmed yet in canon. The helicopter guy was already bitten and the people on the boat were just assholes near as I can tell. If they actually can spread the transmission to non-infected people hasn't been established.

    Aegeri on
    The Roleplayer's Guild: My blog for roleplaying games, advice and adventuring.
  • Undead ScottsmanUndead Scottsman Registered User regular
    edited September 2010
    Aegeri wrote: »
    Aegeri wrote: »
    Yeah, I was amazed at the concept they wouldn't portray the army as being reprehensibly evil. I wonder if we will get an answer about carriers spreading the disease from this.

    ...did you read chapter 2?

    Yes, but I've not actually seen that confirmed yet in canon. The helicopter guy was already bitten and the people on the boat were just assholes near as I can tell. If they actually can spread the transmission to non-infected people hasn't been established.

    The military guys flat-out said it.

    Undead Scottsman on
  • AegeriAegeri Tiny wee bacteriums Plateau of LengRegistered User regular
    edited September 2010
    Flat out said what they believed, but not actually demonstrated they can pass on the infection. There is a considerable difference there. At no point has an actual demonstration that carriers can spread the virus been established just yet. If in the next comic the soldier Rivera (or whatever his name is) develops an infection that would be good evidence. Right now, they've not actually shown if (or how) carriers can spread the infection.

    Aegeri on
    The Roleplayer's Guild: My blog for roleplaying games, advice and adventuring.
  • PopesnaxPopesnax Registered User regular
    edited September 2010
    Aegeri wrote: »
    Flat out said what they believed, but not actually demonstrated they can pass on the infection. There is a considerable difference there.

    Well, they've obviously been studying it for a while, long enough to learn that it can adapt itself stupidly fast and even change transmission vectors practically on the fly, and we know they've had other Tango Mikes, so something must have happened to make everyone suit up in Biological Warfare gear.

    I mean, maybe that's just grunts being paranoid, but I'm pretty sure the government's science teams have had ample opportunity to test whether or not Carriers can transmit the disease, and I doubt they'd waste the resources to maintain a whole separate camp for them if they didn't have evidence supporting the theory.

    At the very least, I think it can be inferred from the fact that the virus can change itself from being airborne to fluid-contact to whatever in a short timespan means that Carriers can sometimes transmit the virus, even if they aren't always a risk.

    Popesnax on
  • JintorJintor Registered User regular
    edited September 2010
    Either way, no sex for carriers

    Jintor on
  • Undead ScottsmanUndead Scottsman Registered User regular
    edited September 2010
    Aegeri wrote: »
    Flat out said what they believed, but not actually demonstrated they can pass on the infection. There is a considerable difference there. At no point has an actual demonstration that carriers can spread the virus been established just yet. If in the next comic the soldier Rivera (or whatever his name is) develops an infection that would be good evidence. Right now, they've not actually shown if (or how) carriers can spread the infection.

    That's kind of a reach IMO. It requires that either

    1. The military is misinformed or outright lying, and given that they consider "Carriers=bad news" as a discussed fact when there was no-one around to lie to tells me they're probably not lying. They've been researching the virus to the point where they determined it mutates like crazy, can be airborne AND not-airborne, and which side the carrier gene runs on, so they're probably not misinformed.
    2. The military doesn't know enough yet, which I would say is damn near impossible considering they know enough to determine the carrier gene runs on the father's side, which means they've encountered and studied carriers before. And given how their entire base is set up to transport, safely contain and examine non-zombies without exposing people, implies to me that they've got good reason to believe what they do.

    From the survivors point of view, yeah it's still up in the air whether it's true or not. But from the reader's point of view, it'd just be silly as hell for it not to be the case.

    Undead Scottsman on
  • AegeriAegeri Tiny wee bacteriums Plateau of LengRegistered User regular
    edited September 2010
    Popesnax wrote: »
    Well, they've obviously been studying it for a while

    Given the lack of communication actually this can be very difficult. I can assure you that without access to resources on a constant basis, like materials for rtPCR (potentially) and online resources like genbank working things out about how the virus works would be very difficult.
    I mean, maybe that's just grunts being paranoid, but I'm pretty sure the government's science teams have had ample opportunity to test whether or not Carriers can transmit the disease

    This is assuming they have the proper equipment, resources and similar to do that to begin with. I am actually utterly unconvinced from the comic they have any of that, especially given that the doctor there doesn't seem to be someone directly scientifically trained (it gave me the impression he's the only person there actually working on it). Trying to do something as major as cloning out genes, sequencing of viral DNA/RNA and similar is a significant undertaking for an entire lab. One guy doing that alone is basically screwed.
    and I doubt they'd waste the resources to maintain a whole separate camp for them if they didn't have evidence supporting the theory.

    I disagree, I believe they'd be so completely paranoid they'd do anything to make themselves safe. The number of people who won't touch someone they know who is infected with HIV, despite the fact we know how it works is quite disturbing. A virus that turns you into a zombie would be even worse.
    At the very least, I think it can be inferred from the fact that the virus can change itself from being airborne to fluid-contact to whatever in a short timespan means that Carriers can sometimes transmit the virus, even if they aren't always a risk.

    That is true, but it has not been established yet what carriers are beyond having the virus. Carriers are not always inherently infectious for example. Let alone what a carrier virus will be doing differently to an active virus that turns you into a zombie.
    The military is misinformed or outright lying, and given that they consider "Carriers=bad news" as a discussed fact when there was no-one around to lie to tells me they're probably not lying.

    This in no way proves they are capable of spreading the infection easily.
    They've been researching the virus to the point where they determined it mutates like crazy, can be airborne AND not-airborne, and which side the carrier gene runs on, so they're probably not misinformed.

    This is all basic information, but none of this is what is actually important for knowing how a virus operates biologically within the host. For example, what it does in a carrier biologically is essential to actually know (and they don't give me the impression they know jack shit about this). For example we know that HIV hides in lymph nodes and is just dormant, riding around in dendritic cells and then deciding to pop out for an infectious cycle. During this time it makes an infectious viremia that can be spread by sexual contact or exposure to blood (as the virus is actually active). The question with carriers is are they simply immune to the symptoms of the virus (for whatever reason it does not replicate within them, but does cause an infection) and can they spread that infection.
    The military doesn't know enough yet, which I would say is damn near impossible considering they know enough to determine the carrier gene runs on the father's side, which means they've encountered and studied carriers before

    They appear to have a single researcher there, who doesn't know anywhere near enough to make such judgements to me. As I explained above, there is a lot to doing proper science on something and they've not given me a single indication they've done it in the comic. Determining a gene that might be responsible for being a carrier is not elucidating the biology of the virus or figuring out what the virus is doing biologically in a carrier.

    Aegeri on
    The Roleplayer's Guild: My blog for roleplaying games, advice and adventuring.
  • Undead ScottsmanUndead Scottsman Registered User regular
    edited September 2010
    Aegeri wrote: »
    This is assuming they have the proper equipment, resources and similar to do that to begin with. I am actually utterly unconvinced from the comic they have any of that, especially given that the doctor there doesn't seem to be someone directly scientifically trained (it gave me the impression he's the only person there actually working on it). Trying to do something as major as cloning out genes, sequencing of viral DNA/RNA and similar is a significant undertaking for an entire lab. One guy doing that alone is basically screwed.
    Yes, because in order to find a cure for Zombism, you need a scientifically accurate amount of equipment and personnel.

    It's a piece of zombie fiction, if a cure is found, it's almost always one guy in a lab. :D

    EDIT: I'll need to reread it, but I don't think they said he was the only guy there. He was just the guy gathering samples: no need to have an entire team there to do that. (Also, he may be a carrier given that he's not in a big suit and willingly takes off his mask.)

    Undead Scottsman on
  • DeMoNDeMoN twitch.tv/toxic_cizzle Registered User regular
    edited September 2010
    Over-analyzing!

    And the pilot in 2 zombified because they were carriers.

    DeMoN on
    Steam id : Toxic Cizzle
    *TyCart*_banner.jpg
  • AegeriAegeri Tiny wee bacteriums Plateau of LengRegistered User regular
    edited September 2010
    Aegeri wrote: »
    This is assuming they have the proper equipment, resources and similar to do that to begin with. I am actually utterly unconvinced from the comic they have any of that, especially given that the doctor there doesn't seem to be someone directly scientifically trained (it gave me the impression he's the only person there actually working on it). Trying to do something as major as cloning out genes, sequencing of viral DNA/RNA and similar is a significant undertaking for an entire lab. One guy doing that alone is basically screwed.
    Yes, because in order to find a cure for Zombism, you need a scientifically accurate amount of equipment and personnel.

    I would actually say so, yes.

    I'm actually a microbiologist "In real life" and I know how damn hard it is to clone proteins out, then figure out what the function of those proteins are. Viral biology is difficult work and requires a lot of materials, cloning and similar experiments to be done. The concept that this one guy knows everything about this virus, when he doesn't even give me that impression is absolutely implausible to me. Until they actually demonstrate transmission directly, it is nowhere near convincing that they are currently a threat.
    EDIT: I'll need to reread it, but I don't think they said he was the only guy there. He was just the guy gathering samples: no need to have an entire team there to do that. (Also, he may be a carrier given that he's not in a big suit and willingly takes off his mask.)

    If he's the only guy there why are they going to shoot him if he can't cure it? It does indeed sound like he's literally the only guy there working on it. That is, inherently doomed to fail horribly to begin with because by the time he's sequenced the virus he's likely to only have the vaguest idea what it does. If he can't access the net for genbank, his job is an impossible uphill climb. Also he states that he is a carrier and that is why he wants to help them escape.

    Aegeri on
    The Roleplayer's Guild: My blog for roleplaying games, advice and adventuring.
  • Undead ScottsmanUndead Scottsman Registered User regular
    edited September 2010
    Aegeri wrote: »
    Aegeri wrote: »
    This is assuming they have the proper equipment, resources and similar to do that to begin with. I am actually utterly unconvinced from the comic they have any of that, especially given that the doctor there doesn't seem to be someone directly scientifically trained (it gave me the impression he's the only person there actually working on it). Trying to do something as major as cloning out genes, sequencing of viral DNA/RNA and similar is a significant undertaking for an entire lab. One guy doing that alone is basically screwed.
    Yes, because in order to find a cure for Zombism, you need a scientifically accurate amount of equipment and personnel.

    I would actually say so, yes.

    I'm actually a microbiologist "In real life" and I know how damn hard it is to clone proteins out, then figure out what the function of those proteins are. Viral biology is difficult work and requires a lot of materials, cloning and similar experiments to be done. The concept that this one guy knows everything about this virus, when he doesn't even give me that impression is absolutely implausible to me. Until they actually demonstrate transmission directly, it is nowhere near convincing that they are currently a threat.

    ZOMBIE GENRAAAAAAA..

    Also I just checked, the doctor definitely spells out that he himself is a carrier. "They only keep me alive to find a cure."

    Undead Scottsman on
  • AegeriAegeri Tiny wee bacteriums Plateau of LengRegistered User regular
    edited September 2010
    Seriously, he wouldn't know jack shit about how to cure the virus if he lacks a resource like genbank. He'd have the following to look at:

    ATCGGGGTTTTAAACCCTATCTATACGGTCAGACCTAAGCCTTTAACCGGTACAAGCCTAAGCTC

    And be utterly screwed if he can't compare that with other viruses to figure out potential target proteins (among other things). The concept that they know everything about this virus, yet have one guy working on it and basically no communication outside (no net for example) is just absurd to me. I also wouldn't be surprised if everyone else there takes his "opinion" a scientific truth, despite the fact I doubt he truly knows what he is talking about given he doesn't give me the impression he knows anything about the actual *viruses* biological behavior.

    Aegeri on
    The Roleplayer's Guild: My blog for roleplaying games, advice and adventuring.
  • Undead ScottsmanUndead Scottsman Registered User regular
    edited September 2010
    Aegeri wrote: »
    Seriously, he wouldn't know jack shit about how to cure the virus if he lacks a resource like genbank. He'd have the following to look at:

    ATCGGGGTTTTAAACCCTATCTATACGGTCAGACCTAAGCCTTTAACCGGTACAAGCCTAAGCTC

    And be utterly screwed if he can't compare that with other viruses to figure out potential target proteins (among other things). The concept that they know everything about this virus, yet have one guy working on it and basically no communication outside (no net for example) is just absurd to me.

    ZOMBIE. FICTION.

    IT'S NOT SCIENTIFICALLY ACCURATE. :P

    Undead Scottsman on
  • AegeriAegeri Tiny wee bacteriums Plateau of LengRegistered User regular
    edited September 2010
    ZOMBIE. FICTION.

    I am well aware of the genre, but at the same time they are using terms that are very scientifically real concepts (carriers for example). What needs to be understood is how the virus functions: What is it actually doing and why is it not killing carriers. Because it is still potentially possible they are either infected but no circulating virus or they are actively infectious but do not display symptoms of disease. At no point have they firmly established how they transmit the virus or if they actually do. Neither am I convinced that the particular situation provides any proof that they do, until they actually directly establish this in a direct way. Given the zombies identify one another as being infected and hence do not attack, I am reticent to believe carriers are actively infected and spreading the virus.

    Aegeri on
    The Roleplayer's Guild: My blog for roleplaying games, advice and adventuring.
  • Undead ScottsmanUndead Scottsman Registered User regular
    edited September 2010
    Aegeri wrote: »
    ZOMBIE. FICTION.

    I am well aware of the genre, but at the same time they are using terms that are very scientifically real concepts (carriers for example). What needs to be understood is how the virus functions: What is it actually doing and why is it making carriers. At no point have they firmly established how they transmit the virus or if they actually do. Neither am I convinced that the particular situation provides any proof that they do, until they actually directly establish this in a direct way.

    Fine, keep vetting plot elements in a zombie comic vs your job and if it really makes you feel better to not be convinced, more power to you.

    Undead Scottsman on
  • PopesnaxPopesnax Registered User regular
    edited September 2010
    Why are we assuming that this one guy in this one facility is the only government scientist studying the virus, again?

    The base in the comics comprises a whole platoon of soldiers and a doctor. I think it should be pretty obvious that this is not a major research installation, or a major installation of any sort so much as the place where they lock the Carriers away as a stop-gap measure to keep them away from the general populace.

    Presumably they have other, properly-staffed facilities where they study ordinary zombies, just like they have other military bases with more than a platoon of soldiers guarding them.

    Popesnax on
  • AegeriAegeri Tiny wee bacteriums Plateau of LengRegistered User regular
    edited September 2010
    I am talking about plot elements: At no point do we ever see actual known transmission of the virus from a carrier to a known uninfected individual. Nor do we have a reliable narrator who establishes this as well in the comic (I do not view the carrier who is trying to save his own skin, or the paranoid military commander as particularly reliable narrators for this).
    Popesnax wrote:
    Why are we assuming that this one guy in this one facility is the only government scientist studying the virus, again?

    Because if there are, then a certain person who doesn't believe he can't cure a certain virus has a lot of explaining to do if the other researches come to the same conclusion he has. It only really makes sense if he's the one doing the research and keeping himself alive by claiming he can cure it. Other individuals that figure out he's lying are probably not going to stand around saying nothing (assuming that carriers can spread the virus as well and they do actually know that, which I am again completely unconvinced they are).

    Aegeri on
    The Roleplayer's Guild: My blog for roleplaying games, advice and adventuring.
  • Undead ScottsmanUndead Scottsman Registered User regular
    edited September 2010
    Like I said, I think you're reaching to achieve that conclusion, but I'm not going to fight you on it any more. We'll find out in a couple weeks either way, most likely.

    Undead Scottsman on
  • BurnageBurnage Registered User regular
    edited September 2010
    Y'know, the thought occurs to me that it wouldn't be entirely crazy for one of the characters introduced in this comic to wind up being a replacement for Bill in the actual game.

    Burnage on
  • Undead ScottsmanUndead Scottsman Registered User regular
    edited September 2010
    If Valve keeps making L4D1 content that is.

    Undead Scottsman on
  • AegeriAegeri Tiny wee bacteriums Plateau of LengRegistered User regular
    edited September 2010
    That would be awesome on so many levels. Then again, when we see them in the DLC in Left4dead 2 there are only the three of them. Then again maybe one of the people from this comic runs into them later?

    Edit: I'm assuming he ends up in Left4dead 2 or something. Or they make new scenarios using the old survivors in L4D2.

    Aegeri on
    The Roleplayer's Guild: My blog for roleplaying games, advice and adventuring.
  • mxmarksmxmarks Registered User regular
    edited September 2010
    I finished reading it and loved it, and thought poor zoe. So sad. Then like 5 minutes later I realized
    carrier gene is on the DADS side. Zoe's father would have never turned. Holy shit that is AWFUL.

    mxmarks on
    PSN: mxmarks - WiiU: mxmarks - twitter: @ MikesPS4 - twitch.tv/mxmarks - "Yes, mxmarks is the King of Queens" - Unbreakable Vow
  • Hung BunnyHung Bunny Registered User regular
    edited September 2010
    Jesus christ are you the same people who also moaned that the body armor made the entire zombie's front bulletproof too?

    Hung Bunny on
  • ZekZek Registered User regular
    edited September 2010
    It's obvious they haven't actually scientifically analyzed the virus to know this stuff about carriers. They probably figured it out from circumstantial evidence, i.e. people getting infected with no exposure to anything but carriers, and fathers often being carriers along with their kids.

    Zek on
  • Roland_tHTGRoland_tHTG Registered User regular
    edited September 2010
    I love how there are mountains of text discussing how the one guy is working in the lab trying to cure the infection alone but nobody has wondered how the boomer and witch got so far inside the compound with the 20 foot walls when it's pretty obvious a hunter couldn't just unlock the gate after jumping over the fence.

    Roland_tHTG on
  • KiasKias Registered User regular
    edited September 2010
    I love how there are mountains of text discussing how the one guy is working in the lab trying to cure the infection alone but nobody has wondered how the boomer and witch got so far inside the compound with the 20 foot walls when it's pretty obvious a hunter couldn't just unlock the gate after jumping over the fence.

    Psht, they clearly researched hunter ventral sacs at their hive.

    Kias on
    steam_sig.png

  • AyulinAyulin Registered User regular
    edited September 2010
    Kias wrote: »
    I love how there are mountains of text discussing how the one guy is working in the lab trying to cure the infection alone but nobody has wondered how the boomer and witch got so far inside the compound with the 20 foot walls when it's pretty obvious a hunter couldn't just unlock the gate after jumping over the fence.

    Psht, they clearly researched hunter ventral sacs at their hive.

    Tank smashed the walls? I dunno. :?

    Ayulin on
    steam_sig.png
Sign In or Register to comment.